| Detail of EST/Unigene TCMT43511 |
| Acc. | TCMT43511 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 704 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (3 ESTs); MT_SIRRA (2 ESTs); MT_JAS_ROOR (2 ESTs); MtBB_NOD (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MTAMP (2 ESTs); MT_VILEAF (1 ESTs); MT_SROOT_KV1 (1 ESTs); MTFLOW (1 ESTs); MT_DSTEM2 (1 ESTs); MHRP-root (1 ESTs); MT_SROOT_KV2 (1 ESTs); |
| Sequence | ATTCGAATATTCAATTATTTTATTCGGAAACATTTTGTTAAGCTCTGCAAAACTAGGGTT |
| EST members of Unigene | AL379576 AL379575 CX539716 CX538866 CX537580 AW691460 AJ503647 AJ503061 BE240662 BM779076 BQ153540 BQ153414 CX517417 CX532246 CX531577 BF004097 AJ497871 EY476566 EY476532 GE350948 GE346066 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.3022.1.S1_at, Mtr.40602.1.S1_at
|
| Corresponding NCBI Gene | 843533 |
| Trichome-related Gene from Literature | N/A |