| Detail of EST/Unigene TCMT46467 |
| Acc. | TCMT46467 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase subunit G OS=Citrus limon E-value=4e-20; V-type proton ATPase subunit G 1 OS=Nicotiana tabacum E-value=3e-19; V-type proton ATPase subunit G1 OS=Arabidopsis thaliana E-value=1e-18; V-type proton ATPase subunit G 2 OS=Nicotiana tabacum E-value=3e-17; V-type proton ATPase subunit G2 OS=Arabidopsis thaliana E-value=2e-13; |
| Length | 771 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (3 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_DSIL (2 ESTs); MtBA (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MTAMP (1 ESTs); MHRP-root (1 ESTs); MT_DLEAF (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SIRRA (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_MGHG (1 ESTs); MT_GSEED (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | GAGAACTAGTCTCGATGTTTTGTTTTGTTTTGCTGGTGATCTTTCTCTCCTATTATTTCA |
| EST members of Unigene | DY615724 AL383791 AL381479 AL381478 CX541392 DW018778 DW016512 AJ504388 BE239728 BG645658 AW775152 BG454441 AW981439 AW776839 BG457840 BQ157329 AL370057 AL370056 BE942376 BG451878 EY477679 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
Mtr.40364.1.S1_at, Mtr.6195.1.S1_s_at
|
| Corresponding NCBI Gene | 821130 |
| Trichome-related Gene from Literature | N/A |