Detail of EST/Unigene TCMT46580 |
Acc. | TCMT46580 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=5e-28; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=1e-14; Carboxymethylenebutenolidase homolog OS=Xenopus laevis E-value=4e-14; Protein AIM2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=9e-14; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=2e-13; |
Length | 1038 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (7 ESTs); MtBB_NOD (4 ESTs); MT_ROOTPHOS (3 ESTs); MTAMP (3 ESTs); MT_KVKC (2 ESTs); MT_ECELL (2 ESTs); MHRP-root (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_HOGA (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DSTEM2 (1 ESTs); |
Sequence | GGAGTGTTGAGTATTGGAGGGAAGTGCAGTTAGCAAAACAAAAAGTCAAAGAAACAAAAA |
EST members of Unigene | CA922940 AL386740 AL386739 AL384945 AL384944 AL382313 AL381883 AL381882 AL380439 AL380438 AL373559 AL373558 AW693806 BF646036 BF643602 AW329850 AW329395 AW328858 AJ503934 AJ502485 AJ502179 BG588744 AW256314 CB893945 BQ255213 BQ165059 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.-.- 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43126.1.S1_at
|
Corresponding NCBI Gene | 821939 |
Trichome-related Gene from Literature | N/A |