Detail of EST/Unigene TCMT46695 |
Acc. | TCMT46695 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 91A1 OS=Arabidopsis thaliana E-value=0; Putative UDP-rhamnose:rhamnosyltransferase 1 OS=Fragaria ananassa E-value=0; UDP-glycosyltransferase 91C1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 91B1 OS=Arabidopsis thaliana E-value=0; Soyasaponin III rhamnosyltransferase OS=Glycine max E-value=0; |
Length | 1613 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (6 ESTs); MTAMP (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_DROOT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_GPOD (1 ESTs); MtSNF (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_HOGA (1 ESTs); MTUS_MIXTISSUE (1 ESTs); |
Sequence | GTAGCTATCTATCTTATTTCACCATGGATGAAGAAAAGGCACTTCACATAGTAATGTTTC |
EST members of Unigene | CA920921 BE319630 BG580963 AJ501608 AJ501325 AW736590 AW736589 BI309345 AJ845708 BE204257 BF638241 CX531204 CX530213 BG647433 AL373014 AL373013 AL370367 AL370366 AL368948 AL368947 EY475059 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10667.1.S1_at
|
Corresponding NCBI Gene | 816790 |
Trichome-related Gene from Literature | N/A |