| Detail of EST/Unigene TCMT46797 |
| Acc. | TCMT46797 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=0; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=0; Cytochrome P450 76C4 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 76C2 OS=Arabidopsis thaliana E-value=0; Cytochrome P450 76C1 OS=Arabidopsis thaliana E-value=0; |
| Length | 1698 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSIL (2 ESTs); MT_JAS_ROOR (2 ESTs); MT_CDS (2 ESTs); MT_ECELL (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MtSNF (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_HOGA (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MTAMP (1 ESTs); |
| Sequence | GGACCATCAAACACTTCTACTAGTGATTTCCTTTGTAAGTGCAACCATTCTCATCTTCAT |
| EST members of Unigene | BT053196 DQ335808 CA922370 BF647092 BF645990 EV262554 EV256429 AJ503816 BQ140475 BQ140002 BF518570 BE124120 AJ845453 AW257505 CX533091 CX532906 CB894187 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10692.1.S1_at
|
| Corresponding NCBI Gene | 819163 |
| Trichome-related Gene from Literature | N/A |