| Detail of EST/Unigene TCMT49636 |
| Acc. | TCMT49636 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 810 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (6 ESTs); MT_JCVI-MT1 (3 ESTs); MT_TRI (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MT_PhoLEAF (2 ESTs); MT_INSECT (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_ROOTPHOS (1 ESTs); MTAMP (1 ESTs); MT_GESD (1 ESTs); MT_DLEAF (1 ESTs); MT_CDS (1 ESTs); MTPOSE (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MtBB_NOD (1 ESTs); MT_MGHG (1 ESTs); MT_GSEED (1 ESTs); MT_Drought (1 ESTs); |
| Sequence | GCAAGAATCTTAAACAAATCTTAGATAGCGTAATCTTTGTTTTTGATTCAAAACAACGCC |
| EST members of Unigene | BT051213 CA922109 AL376353 CX540686 EV258921 EV257499 EV255315 DW017505 AW287872 AJ501019 BI310842 BQ140915 BQ139775 BE318389 AJ498178 BI264616 BE324953 BE942803 BF632597 BI265116 EY474628 GE352331 GE352199 GE347854 GE349978 GE347999 GE344968 ES612765 ES612497 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40607.1.S1_at
|
| Corresponding NCBI Gene | 837452 |
| Trichome-related Gene from Literature | N/A |