Detail of EST/Unigene TCMT53076 |
Acc. | TCMT53076 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucuronate 4-epimerase 5 OS=Arabidopsis thaliana E-value=0; UDP-glucuronate 4-epimerase 3 OS=Arabidopsis thaliana E-value=0; UDP-glucuronate 4-epimerase 2 OS=Arabidopsis thaliana E-value=0; UDP-glucuronate 4-epimerase 4 OS=Arabidopsis thaliana E-value=0; UDP-glucuronate 4-epimerase 1 OS=Arabidopsis thaliana E-value=0; |
Length | 1662 nt |
Species | Medicago truncatula |
Belonged EST Libraries | GLSD (2 ESTs); MT_HOGA (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_DSTEM2 (2 ESTs); MT_JCVI-MT3 (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MTGIM (1 ESTs); MHRP-root (1 ESTs); |
Sequence | GTGACAGTGTAAAAGAAAGGGTGAGGGTTTAGAGAGTTAATAATATGGCGCAGCAAGTGA |
EST members of Unigene | CA922213 AL384871 AL384870 AW560123 AW692753 AW689729 BF644732 EV256229 AJ500068 BE239498 BQ123691 BQ123690 BG647632 BG647172 EY478116 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
EC | 4.2.1.46 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37829.1.S1_at
|
Corresponding NCBI Gene | 826833 |
Trichome-related Gene from Literature | N/A |