Detail of EST/Unigene TCMT58867 |
Acc. | TCMT58867 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Non-specific lipid-transfer protein 4 (Fragment) OS=Lens culinaris E-value=2e-27; Non-specific lipid-transfer protein 2 OS=Lens culinaris E-value=5e-27; Non-specific lipid-transfer protein 6 OS=Lens culinaris E-value=9e-27; Non-specific lipid-transfer protein 5 OS=Lens culinaris E-value=2e-26; Non-specific lipid-transfer protein OS=Cicer arietinum E-value=2e-24; |
Length | 821 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (14 ESTs); MT_VILEAF (12 ESTs); MT_DFLOWER (8 ESTs); MT_GSEED (5 ESTs); MT_JCVI-MT1 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DLEAF (2 ESTs); MT_DSTEM2 (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MHRP-root (1 ESTs); MT_DSIL (1 ESTs); MT_SIRRA (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MTFLOW (1 ESTs); |
Sequence | CCAAAATATTGAATTTGAAACCAAACACATAACCAAATACCTTCTCTCTTATCTTCTATA |
EST members of Unigene | CA922846 CX542353 CX539101 CX538338 CX537212 BQ146082 BE325739 EV261248 EV260176 DW019009 BE239841 BQ147669 BQ146794 BI273154 BI273057 BI272152 BI271086 BI270993 BI270958 BE317524 BF636835 BF520861 BI263775 BI262907 BG458050 BG457351 BG456944 BG456753 BG456595 BG455743 BG455638 BG455324 BG455266 BE324694 BF637915 BF637892 BQ155194 CX522160 CX522144 CX521362 CX520484 CX520428 CX520093 CX519481 CX519328 CX519105 CX517981 CX517406 CX517121 AJ496959 BE248869 EY474165 GE350331 GE345371 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.17550.1.S1_at
|
Corresponding NCBI Gene | 836051 |
Trichome-related Gene from Literature | 836051 |