Detail of EST/Unigene TCMT59001 |
Acc. | TCMT59001 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 860 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_DSIL (3 ESTs); MT_DLEAF (2 ESTs); MT_SIRRA (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DFLOWER (1 ESTs); MT_CDS (1 ESTs); MT_Drought (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_Shoots (1 ESTs); |
Sequence | GCTTTCTTCTAGTTGAGACTTGGACATACCTTGTCCACACACCTATCCTTTGAGTTTGAT |
EST members of Unigene | BT052097 AL381659 AL381658 AW560548 CX524607 EV257965 DW016273 BQ147151 BG452846 BF636755 BF519099 AW776449 AW776187 BQ155808 BI269868 CX520452 CX519446 CX516582 CX516528 BF636494 EY478109 EY475932 GE349121 GE349786 GE344740 GE343994 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1380.1.S1_at, Mtr.20268.1.S1_at
|
Corresponding NCBI Gene | 840297 |
Trichome-related Gene from Literature | N/A |