| Detail of EST/Unigene TCMT59003 |
| Acc. | TCMT59003 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 47 OS=Arabidopsis thaliana E-value=0; Beta-glucosidase 46 OS=Arabidopsis thaliana E-value=0; Beta-glucosidase 45 OS=Arabidopsis thaliana E-value=0; Probable inactive beta-glucosidase 14 OS=Oryza sativa subsp. japonica E-value=0; Beta-glucosidase 18 OS=Oryza sativa subsp. japonica E-value=0; |
| Length | 1520 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (6 ESTs); MTGIM (4 ESTs); MT_SROOT_KV2 (4 ESTs); MT_JCVI-MT1 (3 ESTs); MT_DROOT (1 ESTs); MT_MGHG (1 ESTs); MT_NOD_GVN (1 ESTs); MT_DSLC (1 ESTs); MT_DFLOWER (1 ESTs); MT_GPOD (1 ESTs); MtSNF (1 ESTs); MT_HOGA (1 ESTs); |
| Sequence | GACACAACATATGGAGCTTCCATTCCAACTTCTTCTTCATGTCCTCTTTGTACTAAGCTT |
| EST members of Unigene | BE320886 AW695219 AW697401 AW694718 AW695369 AW697459 AW690127 EV259173 EV257347 EV256988 BG582269 BF006579 AJ499774 AJ499293 AJ500917 AJ500297 BQ147274 BI309327 AJ845835 AW257394 AW256978 AW256488 AI974693 BG648980 BE940972 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
| EC | 3.2.1.108 3.2.1.62 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.27178.1.S1_s_at, Mtr.4299.1.S1_s_at
|
| Corresponding NCBI Gene | 828264 |
| Trichome-related Gene from Literature | N/A |