Detail of EST/Unigene TCMT40125 |
Acc. | TCMT40125 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S17 OS=Solanum lycopersicum E-value=2e-55; 40S ribosomal protein S17-4 OS=Arabidopsis thaliana E-value=9e-54; 40S ribosomal protein S17-2 OS=Arabidopsis thaliana E-value=7e-53; 40S ribosomal protein S17-1 OS=Arabidopsis thaliana E-value=1e-52; 40S ribosomal protein S17-3 OS=Arabidopsis thaliana E-value=2e-52; |
Length | 707 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (6 ESTs); MtBB_NOD (6 ESTs); MTAMP (5 ESTs); MT_JCVI-MT1 (4 ESTs); MT_GESD (4 ESTs); MT_CDS (3 ESTs); MT_JCVI-MT2 (3 ESTs); MT_NOD_GVN (3 ESTs); MT_LEAF_PHOMA (2 ESTs); MT_NOD_ROOT (2 ESTs); MTFLOW (2 ESTs); MtBA (2 ESTs); MT_DFLOWER (1 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); MT_DLEAF (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_GSEED (1 ESTs); GLSD (1 ESTs); MT_PhoLEAF (1 ESTs); MT_VILEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_MGHG (1 ESTs); |
Sequence | GGGCCTCAAACACCAAACCCTAATTCCTCTGCGTCTTCATCTTCCTCCCTTCACCGCACA |
EST members of Unigene | BT051259 BT051243 BT051179 AL389825 AL389824 AL384419 AL384418 AL381867 AL381866 AL378382 AL376841 AL376840 AL375891 AL374817 AL374816 CX537833 EV258567 EV255810 EV255568 EV254965 BG583375 BG582798 BE124745 AW685141 AW683888 AW328842 AJ503514 AJ502236 AJ501794 AJ501200 AJ501154 CA991132 CA991084 BI311618 BI311477 BQ146416 BQ140031 BQ138580 BE318659 AW256923 CA858997 BI264371 CX519092 CX531621 AJ497858 AJ497434 AL365578 AL365577 BE941686 BF635260 BI267105 GE346606 GE346605 GE343785 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02962 small subunit ribosomal protein S17e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1064.1.S1_at, Mtr.12310.1.S1_at
|
Corresponding NCBI Gene | 830359 |
Trichome-related Gene from Literature | N/A |