Detail of EST/Unigene TCMT40193 |
Acc. | TCMT40193 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=6e-72; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=1e-62; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=5e-55; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-54; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-53; |
Length | 1049 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (3 ESTs); MT_JCVI-MT2 (3 ESTs); MT_SROOT_KV1 (2 ESTs); MtBA (2 ESTs); MT_MGHG (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_IROOT_DSIR (1 ESTs); MT_TRI (1 ESTs); MT_UV-B (1 ESTs); MTAMP (1 ESTs); MT_DSIL (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | CAAGTTCTAGTCCATCAAAGTTGACCAAAAACATCACAAACCAAACACTAATCCTTGTCC |
EST members of Unigene | CF068136 CA918930 AL385372 AL385371 AW267974 BF649297 BF646797 BF645437 DY632692 AJ502855 BF519131 CX531414 BF003158 BF003277 AL369968 AL366650 BE942943 BE942837 EY478077 GE352437 GE348123 GE344505 ES612547 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40588.1.S1_at
|
Corresponding NCBI Gene | 820083 |
Trichome-related Gene from Literature | N/A |