| Detail of EST/Unigene TCMT40273 |
| Acc. | TCMT40273 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L34 OS=Pisum sativum E-value=2e-48; 60S ribosomal protein L34 OS=Nicotiana tabacum E-value=7e-47; 60S ribosomal protein L34-2 OS=Arabidopsis thaliana E-value=6e-46; 60S ribosomal protein L34-1 OS=Arabidopsis thaliana E-value=6e-46; 60S ribosomal protein L34-3 OS=Arabidopsis thaliana E-value=9e-44; |
| Length | 641 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (6 ESTs); MT_DFLOWER (4 ESTs); MT_GSEED (3 ESTs); MT_JCVI-MT3 (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_ROOT (2 ESTs); MTAMP (2 ESTs); MT_DLEAF (2 ESTs); MT_HOGA (1 ESTs); MT_ECELL (1 ESTs); MT_MGHG (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_UV-B (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_CDS (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MtBB_NOD (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
| Sequence | GCAAGCTCTTTCATTTTTCTAGGGTTTCATCACAACAATCACCATGGTTCAGAGACTCAC |
| EST members of Unigene | BT051265 DY618183 AL389609 AL384506 AL384505 AL384076 AL384075 AL383339 AL378621 CX539294 CX536052 BI268415 BF650592 EV255856 DY632450 BG448737 AW685009 AW125981 AJ503839 AJ501879 BQ146971 BI271847 BI271648 BI271627 BQ139462 BE317393 BE316218 BE204528 BG646812 BE943507 EY477517 EY475836 EY474901 GE351447 GE346973 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02915 large subunit ribosomal protein L34e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.14381.1.S1_at
|
| Corresponding NCBI Gene | 843298 |
| Trichome-related Gene from Literature | N/A |