| Detail of EST/Unigene TCMT40304 |
| Acc. | TCMT40304 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S27-2 OS=Arabidopsis thaliana E-value=3e-36; 40S ribosomal protein S27 OS=Hordeum vulgare E-value=4e-35; 40S ribosomal protein S27-1 OS=Arabidopsis thaliana E-value=5e-34; 40S ribosomal protein S27-3 OS=Arabidopsis thaliana E-value=7e-34; 40S ribosomal protein S27 OS=Chlamydomonas reinhardtii E-value=5e-30; |
| Length | 785 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (11 ESTs); MT_SIRRA (9 ESTs); MT_GSEED (4 ESTs); MT_DFLOWER (4 ESTs); MT_DLEAF (4 ESTs); MtBC_GLOMUS (3 ESTs); MTFLOW (2 ESTs); MT_GESD (2 ESTs); MT_DROOT (2 ESTs); MT_DSIL (1 ESTs); MT_Shoots (1 ESTs); MT_VILEAF (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_BML (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_CDS (1 ESTs); MHRP-root (1 ESTs); |
| Sequence | ATCTCACATTCTTTTACAACCGTATATTGTGTACATATCAGTTGACACAACATAGATTCA |
| EST members of Unigene | BT053528 AL389109 AL385542 AL385541 AL379931 AL379930 AL378377 AL377626 AL377625 AL377477 AL377476 AL375566 AL375565 AL375320 AL375319 AW687666 BE320534 CX541430 CX539326 CX538044 CX537905 CX523707 BF644124 EV262640 BE997395 AW329345 BI312309 BI311634 BE239494 BQ148048 BQ147119 BI271461 BI271221 BG453490 BG452999 BE318089 BE249393 BE123912 BQ157309 BQ156977 BQ155583 BQ155493 BQ155312 BQ152595 BQ152508 BQ151896 BI269683 CX522817 AJ497990 AJ497849 GD185147 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02978 small subunit ribosomal protein S27e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40110.1.S1_at
|
| Corresponding NCBI Gene | 825283 |
| Trichome-related Gene from Literature | N/A |