Detail of EST/Unigene TCMT40336 |
Acc. | TCMT40336 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein CP24 10A, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein CP24 10B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein CP24, chloroplastic OS=Spinacia oleracea E-value=0; Chlorophyll a-b binding protein, chloroplastic OS=Petunia hybrida E-value=5e-32; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=1e-29; |
Length | 1087 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (34 ESTs); MT_VILEAF (14 ESTs); MT_DLEAF (14 ESTs); MT_INSECT (11 ESTs); MT_DSLC (4 ESTs); MT_LEAF_PHOMA (4 ESTs); MT_DSIL (3 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_GESD (2 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_BML (1 ESTs); MT_TRI (1 ESTs); MT_SROOT_KV2 (1 ESTs); |
Sequence | CTGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
EST members of Unigene | AW692465 EV258041 DW017650 DW015741 AW980360 BF006139 BF005193 BF004897 AW127674 CA918399 BI310691 BQ139956 BQ138629 BQ138571 BQ138282 AW683772 BE318665 BE319051 BE317057 BE318717 AW683712 BE249756 AW683744 BE316701 AW683019 BE318013 BE317458 BF637160 BE249506 BF520833 BF520572 BE124199 AW256790 BI264824 BI264149 BI263513 BI263264 BG457889 BG457798 BG457194 BG456972 BG456877 BG456673 BG456603 BG456486 BG456201 BG456122 BG456058 BG455700 BG455643 BE324767 BE324010 BE323138 BE324412 BE323679 BE324843 BE323559 BE324591 BE324161 BE323980 BE324258 BF639187 BF639007 BF638321 BF638168 BF637864 BF637828 CX522962 CX522088 CX522003 CX521430 CX521337 CX520259 CX519990 CX518998 CX518446 CX518251 CX517801 CX517661 CX517325 CX516858 BI268290 BI267471 BI266129 BI265945 BI265760 BG448827 BF642786 BF642176 BF640661 BF640358 BF639376 GE344149 GD185589 EX529040 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1609.1.S1_at, Msa.1838.1.S1_s_at, Mtr.12305.1.S1_at
|
Corresponding NCBI Gene | 838151 |
Trichome-related Gene from Literature | N/A |