Detail of EST/Unigene TCMT40390 |
Acc. | TCMT40390 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein AB80, chloroplastic OS=Pisum sativum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
Length | 1263 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (29 ESTs); MT_DSIL (16 ESTs); MT_DLEAF (13 ESTs); MT_VILEAF (10 ESTs); MT_INSECT (10 ESTs); MT_DSLC (6 ESTs); MT_UV-B (5 ESTs); MT_LEAF_PHOMA (5 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_DFLOWER (1 ESTs); MT_SIRRA (1 ESTs); MT_DSTEM2 (1 ESTs); MT_TRI (1 ESTs); |
Sequence | TGATTCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | CF068341 CA919027 AW691243 BF006293 BF006135 BF006083 BF006010 BF005130 AW127639 DY633294 DY633278 DY633179 DY633160 DY632905 BI273349 BQ140977 BQ139729 BQ139181 BQ138158 BQ137993 BE318414 BE319099 BE318945 AW683627 BE318623 BE318141 BE319204 BE249645 BE319109 AW683349 BF637052 BE319130 AW683727 BF521391 BF521351 BF521259 BF519708 BF519207 BF518855 BF518594 BE124282 BE124089 BE123935 AW981363 AW777003 AW776736 AW776539 AW776401 AW775961 BI264791 BI264741 BI264668 BI263572 BI263490 BI263409 BI263212 BI262966 BG457690 BG457517 BG457386 BG457193 BG456938 BG455991 BG455857 BG455515 BE323958 BE324237 BE323187 BE324257 BE323072 BE323643 BF639164 BF638999 BF637826 BF637767 BF637648 BF637562 BF637428 BQ152351 CX523559 CX522843 CX520438 CX519828 CX519806 CX519569 CX519457 CX519341 CX518497 CX517613 BI267977 BG448985 BG448980 BE321876 BE321136 BE322253 BE321192 BF642289 BF641519 BE322205 EX528572 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.8438.1.S1_at
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |