Detail of EST/Unigene TCMT41006 |
Acc. | TCMT41006 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquitin-conjugating enzyme E2 5 OS=Arabidopsis thaliana E-value=6e-79; Ubiquitin-conjugating enzyme E2 4 OS=Arabidopsis thaliana E-value=4e-78; Ubiquitin-conjugating enzyme E2-23 kDa OS=Triticum aestivum E-value=9e-78; Ubiquitin-conjugating enzyme E2 6 OS=Arabidopsis thaliana E-value=8e-73; Ubiquitin-conjugating enzyme E2 8 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-63; |
Length | 991 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (13 ESTs); MT_DROOT (3 ESTs); MT_DLEAF (2 ESTs); MT_VILEAF (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_NOD_NOLLY (1 ESTs); MT_DSIL (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_HOGA (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_Drought (1 ESTs); MT_DSLC (1 ESTs); MTAMP (1 ESTs); MT_BML (1 ESTs); MT_DFLOWER (1 ESTs); MT_LEAF_PHOMA (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | DY615986 CA920570 BG448499 AW687792 BE319713 CX523813 DW019169 BE999551 BF006132 AJ503861 BQ148397 BQ138318 BE316407 AW683474 BF521551 BQ159124 BQ159070 BQ158684 BQ158679 BQ158662 BQ158606 BQ158471 BQ158387 BQ158338 BQ158230 BQ157793 BF638067 BF638059 CX523424 CX518309 CX529768 BG648076 BE248383 EY477235 EY474367 GD185905 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10576 ubiquitin-conjugating enzyme E2 H |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
Mtr.12516.1.S1_at
|
Corresponding NCBI Gene | 842683 |
Trichome-related Gene from Literature | N/A |