| Detail of EST/Unigene TCMT41720 |
| Acc. | TCMT41720 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ubiquitin-40S ribosomal protein S27a OS=Lupinus albus E-value=1e-68; Ubiquitin-40S ribosomal protein S27a OS=Solanum tuberosum E-value=1e-67; Ubiquitin-40S ribosomal protein S27a OS=Solanum lycopersicum E-value=1e-67; Ubiquitin-40S ribosomal protein S27a-2 OS=Arabidopsis thaliana E-value=3e-66; Ubiquitin-40S ribosomal protein S27a-3 OS=Arabidopsis thaliana E-value=6e-66; |
| Length | 753 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GSEED (7 ESTs); MtBC_GLOMUS (4 ESTs); MT_DFLOWER (4 ESTs); MtBB_NOD (4 ESTs); MT_PhoLEAF (4 ESTs); MT_SIRRA (4 ESTs); MtBA (3 ESTs); MT_DLEAF (2 ESTs); MT_CDS (1 ESTs); MHRP-root (1 ESTs); MT_BML (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_DSTEM2 (1 ESTs); MT_ECELL (1 ESTs); MTFLOW (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_MGHG (1 ESTs); MT_GESD (1 ESTs); MT_INSECT (1 ESTs); |
| Sequence | TGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
| EST members of Unigene | BT051458 DY618488 AL389146 AL382789 AL381993 AL381960 AL379352 AL379351 AL373521 AL373520 CX542386 CX541977 BQ146073 BQ146050 BQ145800 BQ145595 BQ145451 AW267909 BQ136749 BQ136265 EV258294 AW573912 CA991415 BE240803 AW774157 BI272542 BI271652 BI271268 BI270039 BE315687 AW682940 BE205105 BQ158716 BQ158711 BQ158382 BQ158203 BQ156152 BQ152583 BQ152305 BI269585 AJ497590 AL370753 AL370190 AL370189 BE941035 BQ142400 GD185081 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02977 small subunit ribosomal protein S27Ae |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.12212.1.S1_at
|
| Corresponding NCBI Gene | 819323 |
| Trichome-related Gene from Literature | N/A |