Detail of EST/Unigene TCMT41893 |
Acc. | TCMT41893 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit psaK, chloroplastic OS=Medicago sativa E-value=6e-55; Photosystem I reaction center subunit psaK, chloroplastic OS=Arabidopsis thaliana E-value=6e-45; Photosystem I reaction center subunit psaK, chloroplastic OS=Hordeum vulgare E-value=3e-33; Photosystem I reaction center subunit psaK, chloroplastic OS=Chlamydomonas reinhardtii E-value=4e-15; Photosystem I reaction center subunit psaK, chloroplastic (Fragment) OS=Cucumis sativus E-value=6e-08; |
Length | 736 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DLEAF (30 ESTs); MT_VILEAF (14 ESTs); MT_PhoLEAF (13 ESTs); MT_SIRRA (10 ESTs); MT_JCVI-MT2 (8 ESTs); MT_GSEED (4 ESTs); MT_DFLOWER (2 ESTs); MT_DSIL (2 ESTs); MTPOSE (1 ESTs); MT_TRI (1 ESTs); MT_DSLC (1 ESTs); MT_GESD (1 ESTs); |
Sequence | CGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGC |
EST members of Unigene | CX541708 CX539707 CX538893 CX537553 BF005155 BI311825 BQ149837 BI271316 BQ151567 BG454597 BE318294 AW682926 BE317291 AW683008 AW683739 BE316859 BE316514 BE249298 BE316877 BE317717 BE317427 BE249463 BE317796 BE249263 BE317222 BE317493 AW683389 BE249771 AW683547 BE317659 BE316693 AW683728 BF637308 BF637141 BF636731 BE316744 AW683444 AW683359 BF521556 BF520258 AJ498747 BI264886 BI264831 BI263853 BI263794 BI263720 BI263611 BG457908 BG457710 BG456227 BG455731 BE323085 BF637766 BE324969 BQ157525 BQ157150 BQ156589 BQ155640 BQ154569 BQ154144 BQ153828 BQ153557 BQ153328 BQ152792 CX523581 CX523567 CX523340 CX522412 CX521646 CX521271 CX520648 CX520516 CX520121 CX519997 CX519558 CX519133 CX518374 CX516569 GE350466 GE347076 GE350028 GE349936 GE345522 GE343922 GE345024 GE344919 ES612817 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3118.1.S1_at, Mtr.12308.1.S1_at
|
Corresponding NCBI Gene | 839918 |
Trichome-related Gene from Literature | N/A |