Detail of EST/Unigene TCMT42002 |
Acc. | TCMT42002 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV, chloroplastic OS=Spinacia oleracea E-value=1e-27; Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=1e-27; Photosystem I reaction center subunit IV B, chloroplastic OS=Arabidopsis thaliana E-value=1e-27; Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=3e-27; Photosystem I reaction center subunit IV A, chloroplastic OS=Arabidopsis thaliana E-value=9e-27; |
Length | 724 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_VILEAF (79 ESTs); MT_DLEAF (20 ESTs); MT_PhoLEAF (19 ESTs); MT_SIRRA (14 ESTs); MT_DSIL (11 ESTs); MT_JCVI-MT2 (5 ESTs); MT_GSEED (4 ESTs); MT_DSLC (4 ESTs); MT_DFLOWER (4 ESTs); MT_Shoots (3 ESTs); MT_GESD (3 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_Drought (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_INSECT (2 ESTs); MT_CDS (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_TRI (1 ESTs); |
Sequence | CACTTCACTCACTCAAAGCCTCTCAAACTACAATCTAATCTTGTCCTTTTGCCACATTAA |
EST members of Unigene | BT053266 CF068629 CA919213 CX540955 CX538920 CX538622 CX537701 CX527871 CX527228 CX523765 EV259751 EV257588 DW017553 BF006196 BF006057 BF005837 BF005551 BI311160 BI310584 BI310501 BQ149033 BQ147598 BQ147567 BQ147551 BG453942 BG453287 BG452952 BE316202 BE316811 BE318848 BE318853 BE318947 BE316313 BE315606 BE316267 BE318689 BE316337 BE316651 BE249683 BE318540 BE317739 BE316134 BF637214 AW683324 BF520445 BF520212 BF519461 BF519353 BF518827 AW981258 AW777006 AW776955 AW776780 AW776515 AW775644 BI264966 BI263564 BI263455 BI263245 BI262934 BG458192 BG457898 BG457653 BG457019 BG456610 BE324917 BE323922 BE324012 BE324268 BF639171 BF639018 BF638048 BF637697 BF637631 BQ157034 BQ156747 BQ156326 BQ156239 BQ155930 BQ155161 BQ153570 BQ153451 BQ152907 BQ152503 BQ151888 BI269954 BI269252 BI269092 CX523565 CX523543 CX523512 CX522982 CX522961 CX522862 CX522859 CX522848 CX522796 CX522791 CX522763 CX522758 CX522731 CX522703 CX522690 CX522585 CX522514 CX522396 CX522235 CX522195 CX522106 CX522036 CX521956 CX521587 CX521370 CX521360 CX521149 CX521143 CX521139 CX521059 CX520917 CX520908 CX520898 CX520839 CX520618 CX520606 CX520287 CX520266 CX520211 CX520145 CX520139 CX520105 CX520043 CX519943 CX519871 CX519722 CX519716 CX519526 CX519217 CX519019 CX518989 CX518903 CX518829 CX518724 CX518688 CX518626 CX518388 CX518276 CX518245 CX518240 CX518149 CX518106 CX518034 CX517784 CX517761 CX517732 CX517588 CX517548 CX517543 CX517459 CX517314 CX517202 CX517199 CX517173 CX517091 CX516991 CX516970 CX516942 CX516866 BG451675 BF632892 BI266168 BF639719 GE351046 GE349738 GE344688 GE346240 GE343799 EX532693 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3039.1.S1_at, Mtr.10403.1.S1_at
|
Corresponding NCBI Gene | 816545 |
Trichome-related Gene from Literature | N/A |