Detail of EST/Unigene TCMT42120 |
Acc. | TCMT42120 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b5 OS=Brassica oleracea var. botrytis E-value=6e-40; Cytochrome b5 isoform 1 OS=Arabidopsis thaliana E-value=6e-39; Cytochrome b5 OS=Nicotiana tabacum E-value=1e-38; Probable cytochrome b5 isoform 2 OS=Arabidopsis thaliana E-value=6e-37; Cytochrome b5, seed isoform OS=Nicotiana tabacum E-value=1e-36; |
Length | 864 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (4 ESTs); MT_DROOT (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_CDS (2 ESTs); MT_GSEED (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MT_SROOT_KV1 (1 ESTs); MtRHE (1 ESTs); MT_MGHG (1 ESTs); MT_ECELL (1 ESTs); MT_ROOTPHOS (1 ESTs); MHRP-root (1 ESTs); MT_DSIL (1 ESTs); |
Sequence | GAACATAACATCATCGTTGCAACAACTACCGTCTCAAAACTCATCACCAACCTCTGTCAA |
EST members of Unigene | BT051508 BT051345 AW686999 BE320383 BE319583 CX537270 BQ146138 BF650681 EV258823 EV257891 EV256879 DW019138 DW018858 AW328862 BE239337 BF519436 BF004128 AA660459 BE943382 GE350819 GE352536 GE348239 GE345927 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00326 cytochrome-b5 reductase; Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K10226 fatty acid desaturase 2 (delta-6 desaturase); Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10226 fatty acid desaturase 2 (delta-6 desaturase) |
EC | 1.14.19.- 1.6.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37820.1.S1_at
|
Corresponding NCBI Gene | 835438 |
Trichome-related Gene from Literature | N/A |