Detail of EST/Unigene TCMT43383 |
Acc. | TCMT43383 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b-c1 complex subunit 8 OS=Solanum tuberosum E-value=2e-27; |
Length | 674 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBB_NOD (6 ESTs); MT_JCVI-MT2 (3 ESTs); MtBC_GLOMUS (2 ESTs); MT_HOGA (2 ESTs); MT_GSEED (2 ESTs); MT_Drought (2 ESTs); MT_GESD (1 ESTs); MT_DSIL (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_PhoLEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MtBA (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_INSECT (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_ROOTPHOS (1 ESTs); |
Sequence | TATAGGTCGCGCGCTTTAGCGCCATCCATTTTCGGGGCTGGTTGATTCGCATTCTCATTC |
EST members of Unigene | AL384899 AL384898 AL376647 AL376646 AL376456 AL375738 AL374534 AL374533 CX538533 CX538125 EV256433 DW019360 AW287883 BI311131 BF520798 BE203593 BG457167 CX529988 CB893736 BG647152 AL372775 BE248447 BF636558 BF642220 EY474178 GE351400 GE346920 GE343962 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1539.1.S1_at, Mtr.12501.1.S1_at
|
Corresponding NCBI Gene | 830419 |
Trichome-related Gene from Literature | N/A |