Detail of EST/Unigene TCMT46309 |
Acc. | TCMT46309 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable ribosome biogenesis protein RLP24 OS=Arabidopsis thaliana E-value=6e-56; Probable ribosome biogenesis protein RLP24 OS=Dictyostelium discoideum E-value=9e-41; Probable ribosome biogenesis protein RLP24 OS=Mus musculus E-value=1e-38; Probable ribosome biogenesis protein RLP24 OS=Rattus norvegicus E-value=3e-38; Probable ribosome biogenesis protein RLP24 OS=Homo sapiens E-value=3e-38; |
Length | 857 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (10 ESTs); MT_JCVI-MT3 (4 ESTs); MT_GSEED (3 ESTs); MtBB_NOD (2 ESTs); MtBA (2 ESTs); MT_ECELL (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_DFLOWER (2 ESTs); MT_SIRRA (2 ESTs); MtRHE (1 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_GVN (1 ESTs); MT_GESD (1 ESTs); MT_DLEAF (1 ESTs); MT_CDS (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_HOGA (1 ESTs); |
Sequence | CTAACATCAGTGGCGGCCACACCGCCCCGACATTAGGGTTTATCATCATCTCCTCCTTAT |
EST members of Unigene | BT053413 DY617086 AL374883 AL374882 CX537726 CX536162 BI268429 BF648536 BF645640 EV261393 EV260157 DW016363 AW573667 BI310411 BQ146842 BI270952 BE317108 BQ152798 BQ152667 BG647013 AA660732 AL368638 AL368637 BF632094 BI265295 EY478785 EY478380 EY476727 EY475969 GE351797 GE350867 GE352041 GE349693 GE347395 GE350007 GE347672 GE344643 GE345003 GE345980 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02896 large subunit ribosomal protein L24e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1218.1.S1_at, Mtr.16619.1.S1_at
|
Corresponding NCBI Gene | 819095 |
Trichome-related Gene from Literature | N/A |