Detail of EST/Unigene TCMT46709 |
Acc. | TCMT46709 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase 2 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase kinase 1 OS=Arabidopsis thaliana E-value=0; Mitogen-activated protein kinase kinase 1 OS=Oryza sativa subsp. japonica E-value=0; Mitogen-activated protein kinase kinase 6 OS=Arabidopsis thaliana E-value=0; Dual specificity mitogen-activated protein kinase kinase dSOR1 OS=Drosophila melanogaster E-value=6e-55; |
Length | 1755 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG (3 ESTs); MtBA (3 ESTs); MT_GESD (2 ESTs); MT_VILEAF (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); MT_INSECT (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MtSNF (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | TGAAAAATCAACAAAACAAGAGTCTCCATCCTCAAAAGCTGCTTCCTTCAATTTATCCTC |
EST members of Unigene | CA920784 CX527699 BF646942 EV260610 DW019366 CA918603 CA918602 BG644803 AJ845485 BE203971 CX521479 CX520964 AL372997 AL369291 AL369290 BE942892 BE942644 BE942641 BI266234 EY474607 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1 |
EC | 2.7.12.2 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
Msa.894.1.S1_at, Mtr.40536.1.S1_at
|
Corresponding NCBI Gene | 829103 |
Trichome-related Gene from Literature | N/A |