Detail of EST/Unigene TCMT53368 |
Acc. | TCMT53368 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Argininosuccinate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; Argininosuccinate synthase OS=Roseiflexus sp. (strain RS-1) E-value=9e-84; Argininosuccinate synthase OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=1e-82; Argininosuccinate synthase OS=Desulfotomaculum reducens (strain MI-1) E-value=1e-81; Argininosuccinate synthase OS=Roseiflexus castenholzii (strain DSM 13941 / HLO8) E-value=2e-80; |
Length | 897 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (2 ESTs); MT_GPOD (1 ESTs); MT_DSIL (1 ESTs); MT_JCVI-MT3 (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_NOD_ROOT (1 ESTs); MTGIM (1 ESTs); MT_GESD (1 ESTs); |
Sequence | TATGGCGCAGTTGAATGCAATTCTTACATACTCATCCCCAGCTATTGCTCCTACCAAACA |
EST members of Unigene | AL385506 BG448770 AJ499921 CA990104 CB891774 BG645371 CA917816 BF518874 EY476409 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01940 argininosuccinate synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01940 argininosuccinate synthase |
EC | 6.3.4.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.52006.1.S1_at
|
Corresponding NCBI Gene | 828586 |
Trichome-related Gene from Literature | N/A |