Detail of EST/Unigene TCMT55887 |
Acc. | TCMT55887 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Endo-1,3;1,4-beta-D-glucanase OS=Zea mays E-value=4e-35; Protein AIM2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=5e-20; Carboxymethylenebutenolidase homolog OS=Xenopus tropicalis E-value=3e-19; Carboxymethylenebutenolidase homolog OS=Xenopus laevis E-value=2e-18; Carboxymethylenebutenolidase homolog OS=Mus musculus E-value=4e-18; |
Length | 1280 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (5 ESTs); MT_FLOSEED_MTY (3 ESTs); MT_INSECT (3 ESTs); MTUS_MIXTISSUE (3 ESTs); MT_JCVI-MT2 (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_DSIL (2 ESTs); MT_Drought (2 ESTs); MT_CDS (2 ESTs); MT_JCVI-MT3 (1 ESTs); MT_DSTEM2 (1 ESTs); MT_NOD_GVSN (1 ESTs); MHRP-root (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | GATGAAAGATTCCATTGTTTATTCTGTTTGCAAAGAGTTGAAAGGCTTTAGAAATTAGAA |
EST members of Unigene | BT052538 BT052369 CF069989 CA920316 CA920308 AL387547 AL387546 AL385838 AL385364 AL385363 AW693653 EV261269 EV259880 DW018106 DW016465 DW015914 BE998769 BE240734 BF518414 BE124134 BE324327 BG450803 BF633137 BI265143 BE322135 BF641482 EY474156 GE352067 GE347702 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00627 1,4-Dichlorobenzene degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00364 Fluorobenzoate degradation > K01061 carboxymethylenebutenolidase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K01061 carboxymethylenebutenolidase |
EC | 3.1.1.45 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1921.1.S1_at, Mtr.40550.1.S1_at
|
Corresponding NCBI Gene | 821939 |
Trichome-related Gene from Literature | N/A |