Detail of EST/Unigene TCMT55946 |
Acc. | TCMT55946 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | unknown |
Length | 857 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (3 ESTs); MtBB_NOD (3 ESTs); MT_DFLOWER (2 ESTs); MT_JCVI-MT2 (2 ESTs); MTAMP (1 ESTs); MT_DLEAF (1 ESTs); GLSD (1 ESTs); MT_VILEAF (1 ESTs); MT_GSEED (1 ESTs); MT_HOGA (1 ESTs); MT_Shoots (1 ESTs); MT_INSECT (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_ROOTPHOS (1 ESTs); |
Sequence | CTCTCTGTGTTGCACATAAATGATTAAACTCTAGCCAAAGGAGTTAACCAACAACATCCG |
EST members of Unigene | AL388779 AL381786 AL381785 AL381023 AL379572 AL379571 CX539566 CX526590 BF647301 EV256439 AW684694 AW126368 AJ504279 BQ148848 BQ146952 BE249576 CA989789 CX522084 BG647718 BI267451 EY477896 GE351882 GE347491 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.2655.1.S1_at, Mtr.10660.1.S1_at
|
Corresponding NCBI Gene | 838496 |
Trichome-related Gene from Literature | N/A |