| Detail of EST/Unigene TCMT58997 |
| Acc. | TCMT58997 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S12 OS=Hordeum vulgare E-value=3e-52; 40S ribosomal protein S12-2 OS=Arabidopsis thaliana E-value=2e-50; 40S ribosomal protein S12-1 OS=Arabidopsis thaliana E-value=4e-48; 40S ribosomal protein S12 OS=Cyanophora paradoxa E-value=4e-36; 40S ribosomal protein S12 OS=Sus scrofa E-value=9e-36; |
| Length | 733 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (4 ESTs); MT_NOD_NOLLY (3 ESTs); MtBB_NOD (3 ESTs); MT_PhoLEAF (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_Drought (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); MT_VILEAF (1 ESTs); MT_SROOT_KV1 (1 ESTs); MTFLOW (1 ESTs); MT_GSEED (1 ESTs); MT_DSTEM2 (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MHRP-root (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | GGTAGCAATTGCAGAACTAGGGTTTTCGGCGGCACAATCGTCTTCAACAACAAGAAAGGA |
| EST members of Unigene | DY618146 DY617454 DY616130 AL387279 AL383268 AL376889 AL375806 AL375805 CX538632 BE326099 AW329203 AW126270 BG588546 AW773925 BG453636 BI308035 BG456401 BG456266 CX521541 BE203042 AJ497305 BG451024 BG450629 BF641712 EY478478 GE351841 GE347441 GE345344 GE343451 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02951 small subunit ribosomal protein S12e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.15415.1.S1_at
|
| Corresponding NCBI Gene | 817766 |
| Trichome-related Gene from Literature | N/A |