Detail of EST/Unigene TCMT40889 |
Acc. | TCMT40889 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | SNAP25 homologous protein SNAP33 OS=Arabidopsis thaliana E-value=7e-72; Putative SNAP25 homologous protein SNAP30 OS=Arabidopsis thaliana E-value=7e-66; SNAP25 homologous protein SNAP29 OS=Arabidopsis thaliana E-value=4e-50; Synaptosomal-associated protein 25 OS=Rattus norvegicus E-value=2e-11; Synaptosomal-associated protein 25 OS=Pan troglodytes E-value=2e-11; |
Length | 1380 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (13 ESTs); MT_DROOT (5 ESTs); MTUS_MIXTISSUE (4 ESTs); MT_DSIL (4 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MT_LEAF_PHOMA (3 ESTs); MT_NOD_GVSN (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_ROOTPHOS (2 ESTs); MtBB_NOD (2 ESTs); MT_HOGA (2 ESTs); MT_IROOT_DSIR (2 ESTs); MT_SROOT_KV1 (2 ESTs); MtBA (2 ESTs); MTAMP (1 ESTs); MT_PhoLEAF (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_Drought (1 ESTs); |
Sequence | TCTTGTTGGCTGCTTTCCTTTGACATTCCTCTTGCCTTCTTCAGCTTATGACTTTTTCTT |
EST members of Unigene | CF069847 CA920284 CA922368 CA922224 AL374385 AL374384 AW687611 BE319257 AW687042 BE320621 BE320910 AW559781 AW559324 BF650713 BF650125 BF648621 BF648316 BF648076 BF647471 BF647101 BF646518 BF646422 BF646309 BF646300 BF644908 BF644158 EV260085 BE998952 BE997400 AW126355 AW126001 AJ503221 CB891513 BG645309 BG645150 BQ140231 BQ138666 BQ138116 BF519494 BF519075 BF519071 AW127336 BI263146 CB893577 BG648086 BF003291 BE202733 AL366950 AL366949 BF632907 EY477004 EY476960 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04130 SNARE interactions in vesicular transport > K08508 synaptosomal-associated protein, 23kDa |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37410.1.S1_at
|
Corresponding NCBI Gene | 836242 |
Trichome-related Gene from Literature | N/A |