| Detail of EST/Unigene TCMT41602 |
| Acc. | TCMT41602 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S20-2 OS=Arabidopsis thaliana E-value=6e-56; 40S ribosomal protein S20-1 OS=Arabidopsis thaliana E-value=3e-55; 40S ribosomal protein S20 OS=Oryza sativa subsp. japonica E-value=8e-50; 40S ribosomal protein S20 OS=Rattus norvegicus E-value=2e-43; 40S ribosomal protein S20 OS=Mus musculus E-value=2e-43; |
| Length | 727 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (5 ESTs); MT_GSEED (4 ESTs); MT_DROOT (2 ESTs); MtBA (2 ESTs); MT_Drought (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_DLEAF (2 ESTs); MtBC_GLOMUS (2 ESTs); MT_JAS_ROOR (2 ESTs); MtBB_NOD (1 ESTs); MT_HOGA (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_MGHG (1 ESTs); MTAMP (1 ESTs); MT_TRI (1 ESTs); MT_PhoLEAF (1 ESTs); MT_VILEAF (1 ESTs); |
| Sequence | CTGATACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | AL384618 AL383527 AL378199 BE320856 AW687748 CX541509 CX536927 CX536821 BI268845 AW561083 AJ502950 CB891658 BG645641 BG453063 BG452694 BG456194 BQ157636 BQ155755 BQ154793 BQ154087 BQ153649 CX522347 CX530900 CX530137 BG648128 BF004245 AL371721 AL371720 BE941867 BQ144152 BF632783 GE352820 GE348565 EX531401 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02969 small subunit ribosomal protein S20e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10476.1.S1_at
|
| Corresponding NCBI Gene | 823891 |
| Trichome-related Gene from Literature | N/A |