| Detail of EST/Unigene TCMT41826 |
| Acc. | TCMT41826 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S29 OS=Arabidopsis thaliana E-value=6e-27; 40S ribosomal protein S29 OS=Triticum aestivum E-value=4e-26; 40S ribosomal protein S29 OS=Griffithsia japonica E-value=1e-19; 40S ribosomal protein S29 OS=Ixodes scapularis E-value=2e-17; 40S ribosomal protein S29A OS=Guillardia theta E-value=3e-17; |
| Length | 586 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBB_NOD (10 ESTs); MT_SIRRA (7 ESTs); MT_JCVI-MT2 (6 ESTs); MtBC_GLOMUS (3 ESTs); MT_TRI (2 ESTs); MT_GESD (2 ESTs); MT_DFLOWER (2 ESTs); MT_NOD_GVN (1 ESTs); MT_ROOTPHOS (1 ESTs); MTAMP (1 ESTs); MHRP-root (1 ESTs); MT_DROOT (1 ESTs); MT_VILEAF (1 ESTs); MT_GSEED (1 ESTs); MTFLOW (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_GVSN (1 ESTs); |
| Sequence | TGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
| EST members of Unigene | AL389801 AL389800 AL386607 AL379941 AL379940 AL379905 AL379904 AL378496 AL378495 AL377550 AL377549 AL374885 AL374884 BE320802 CX538252 DW018932 BE998340 AW981102 AW126377 AJ501712 BI310334 BI310298 BG588841 BQ146791 BQ146264 BQ156762 BQ155654 BQ155297 BQ154474 BQ153257 BI269108 BI269056 CX518301 AJ497189 GE351532 GE352386 GE350641 GE347084 GE348062 GE345728 EX531930 EX528283 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02980 small subunit ribosomal protein S29e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42990.1.S1_at
|
| Corresponding NCBI Gene | 829529 |
| Trichome-related Gene from Literature | N/A |