Detail of EST/Unigene TCMT42641 |
Acc. | TCMT42641 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquitin-60S ribosomal protein L40 OS=Nicotiana sylvestris E-value=1e-64; Ubiquitin-60S ribosomal protein L40-2 OS=Oryza sativa subsp. japonica E-value=2e-64; Ubiquitin-60S ribosomal protein L40-2 OS=Arabidopsis thaliana E-value=2e-64; Ubiquitin-60S ribosomal protein L40-1 OS=Oryza sativa subsp. japonica E-value=2e-64; Ubiquitin-60S ribosomal protein L40-1 OS=Arabidopsis thaliana E-value=2e-64; |
Length | 689 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (5 ESTs); MtBC_GLOMUS (3 ESTs); MtBB_NOD (3 ESTs); MT_SIRRA (2 ESTs); MtBA (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_ROOTPHOS (2 ESTs); MT_SROOT_KV2 (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_HOGA (1 ESTs); MT_DROOT (1 ESTs); MT_MGHG (1 ESTs); MT_ECELL (1 ESTs); MT_TRI (1 ESTs); MT_DFLOWER (1 ESTs); MTPOSE (1 ESTs); |
Sequence | GNGTTCAGCTATGCAGATATTCGTGAAAACCCTAACAGGGAAGACAATTACTCTCGAAGT |
EST members of Unigene | AL388631 AL388630 AL387618 AL377255 AL377210 AL377209 AW687142 CX538396 CX538269 CX538220 CX538085 CX537061 BF649721 AW287932 AW329799 BI271992 AJ498085 BM778930 BQ156225 BQ154880 CX532559 BG646352 AL370192 AL370191 BE943502 EY477019 EY476570 GE349874 GE344840 EX530157 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02927 large subunit ribosomal protein L40e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1502.1.S1_at, Mtr.42861.1.S1_at, Mtr.42861.1.S1_s_at
|
Corresponding NCBI Gene | 824425 |
Trichome-related Gene from Literature | N/A |