Detail of EST/Unigene TCMT42779 |
Acc. | TCMT42779 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ubiquitin-conjugating enzyme E2 variant 1D OS=Arabidopsis thaliana E-value=1e-68; Ubiquitin-conjugating enzyme E2 variant 1C OS=Arabidopsis thaliana E-value=4e-68; Ubiquitin-conjugating enzyme E2 variant 1A OS=Arabidopsis thaliana E-value=1e-50; Ubiquitin-conjugating enzyme E2 variant 1B OS=Arabidopsis thaliana E-value=3e-49; Probable ubiquitin-conjugating enzyme E2 variant OS=Dictyostelium discoideum E-value=2e-35; |
Length | 969 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (6 ESTs); MtBA (5 ESTs); MT_ECELL (4 ESTs); MT_JCVI-MT1 (4 ESTs); MTFLOW (4 ESTs); MT_JCVI-MT2 (4 ESTs); MT_NOD_GVN (3 ESTs); MT_MGHG (3 ESTs); MT_CDS (3 ESTs); MT_DROOT (3 ESTs); MT_DSTEM2 (2 ESTs); MTAMP (2 ESTs); MT_LEAF_PHOMA (2 ESTs); MtBB_NOD (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_GSEED (2 ESTs); GLSD (1 ESTs); MT_VILEAF (1 ESTs); MT_JAS_ROOR (1 ESTs); MHRP-root (1 ESTs); MT_DFLOWER (1 ESTs); MT_INSECT (1 ESTs); MTPOSE (1 ESTs); |
Sequence | GGGTACAAGGGACCATTCCAAATTTCAAGAAAATCTTAACCCGATCAGCACTCCATTTTC |
EST members of Unigene | BT053587 BT050621 BT050601 AL375993 AL375992 BE319956 BE320826 AW687778 CX541189 CX541140 BE325644 AW695768 BG447814 BF650664 BF645056 BF644543 EV260102 EV259430 EV257076 EV255439 BG583748 BG583057 BG580268 AJ503303 AJ501358 BE239585 BI270710 BQ138913 BQ138182 AJ498091 BE203890 BE203629 CA858786 BQ157212 BQ156633 BQ156318 BQ154240 BQ152958 BI269581 CX521281 CX530538 AJ497903 AJ497235 AJ497059 AJ496914 AL371455 AL371454 AL367021 AL366631 AL366630 BE942147 BE941339 BE941100 BF642634 GE351500 GE347047 GE349024 GE343882 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1104.1.S1_at
|
Corresponding NCBI Gene | 818179 |
Trichome-related Gene from Literature | N/A |