| Detail of EST/Unigene TCMT43264 |
| Acc. | TCMT43264 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L26-2 OS=Arabidopsis thaliana E-value=3e-44; 60S ribosomal protein L26-1 OS=Arabidopsis thaliana E-value=3e-43; 60S ribosomal protein L26 OS=Brassica rapa E-value=6e-38; 60S ribosomal protein L26-like 1 OS=Homo sapiens E-value=6e-33; 60S ribosomal protein L26 OS=Mus musculus E-value=8e-33; |
| Length | 693 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (6 ESTs); MT_JCVI-MT2 (6 ESTs); MT_GESD (3 ESTs); MT_TRI (2 ESTs); MT_DFLOWER (2 ESTs); MT_PhoLEAF (2 ESTs); MT_NOD_GVN (2 ESTs); MTAMP (2 ESTs); MHRP-root (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_SIRRA (1 ESTs); MT_DROOT (1 ESTs); MT_VILEAF (1 ESTs); MT_GSEED (1 ESTs); MT_HOGA (1 ESTs); MT_ECELL (1 ESTs); MTFLOW (1 ESTs); MT_MGHG (1 ESTs); MtSN4 (1 ESTs); |
| Sequence | GCTAGCCAACACTAGCAGCAGCTGAATCTGTGAGAGAGCGAAAATGAAGTTCAACCCAAG |
| EST members of Unigene | CA920397 AL384624 AL384623 AL383940 AL383939 AL381953 AL381952 BE320749 CX537444 BG448330 BG580487 BE124772 AJ502539 AJ502269 AJ848496 CA990816 CA990789 BI310170 BG588415 BQ148015 BQ146784 BG458196 BG455564 BQ153678 CX517518 BG646351 AJ497391 BE942619 GE351485 GE352351 GE349592 GE347024 GE348024 GE344524 EX527159 EX526966 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02898 large subunit ribosomal protein L26e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1886.1.S1_at, Mtr.12438.1.S1_at
|
| Corresponding NCBI Gene | 836887 |
| Trichome-related Gene from Literature | N/A |