| Detail of EST/Unigene TCMT46559 |
| Acc. | TCMT46559 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Basic blue protein OS=Cucumis sativus E-value=3e-34; Basic blue protein OS=Arabidopsis thaliana E-value=4e-34; Chemocyanin OS=Lilium longiflorum E-value=4e-31; Mavicyanin OS=Cucurbita pepo E-value=7e-16; Blue copper protein OS=Pisum sativum E-value=1e-14; |
| Length | 815 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (11 ESTs); MT_JCVI-MT3 (2 ESTs); MT_DSIL (2 ESTs); MT_CDS (1 ESTs); MT_SROOT_KV1 (1 ESTs); MtBA (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_DSTEM2 (1 ESTs); MT_TRI (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_ROOTPHOS (1 ESTs); MHRP-root (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_DLEAF (1 ESTs); |
| Sequence | AAGGGTTAAGTCTCAACCTTGCAAACCAACTCAACCATCTCACTATAATTGCTATAGGCA |
| EST members of Unigene | BT051530 AL389869 AL388518 AL388517 AL387980 AL387979 AL387511 AL387510 AL386450 AL386449 AL386198 AL386197 AW559580 AW694162 EV259074 AW574123 AW126347 BG588756 AW774308 AW682969 AW127515 AW775411 BE203189 AL366610 EY477259 EY475298 ES613718 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.1617.1.S1_s_at, Mtr.37517.1.S1_at
|
| Corresponding NCBI Gene | 814816 |
| Trichome-related Gene from Literature | N/A |