| Detail of EST/Unigene TCMT49492 |
| Acc. | TCMT49492 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L24 OS=Cicer arietinum E-value=5e-57; 60S ribosomal protein L24 OS=Prunus avium E-value=6e-57; 60S ribosomal protein L24-2 OS=Arabidopsis thaliana E-value=7e-56; 60S ribosomal protein L24-1 OS=Arabidopsis thaliana E-value=9e-56; 60S ribosomal protein L24 OS=Hordeum vulgare E-value=3e-53; |
| Length | 715 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (9 ESTs); MtBC_GLOMUS (2 ESTs); MT_JCVI-MT1 (2 ESTs); MTAMP (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MTFLOW (1 ESTs); MT_GSEED (1 ESTs); MT_Drought (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_GESD (1 ESTs); MT_DLEAF (1 ESTs); MT_DSIL (1 ESTs); MT_CDS (1 ESTs); MT_SROOT_KV0 (1 ESTs); MT_NOD_NOLLY (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_SROOT_KV1 (1 ESTs); |
| Sequence | GGGGGGTTTACATTTACAAAGAGCAGCCACCACAGCGACGAAGCAGCCATGGTTCTCAAA |
| EST members of Unigene | BT053534 DY618498 CF069905 CA920244 AL382974 AL382973 CX540428 EV262694 EV256221 BE998154 AJ503674 AJ501443 CA990441 BE317811 AW776996 BE205455 CX533551 BF003843 AJ496877 BF633929 GE350920 GE351185 GE349073 GE349939 GE343938 GE346552 GE346551 GE346037 GE344923 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02896 large subunit ribosomal protein L24e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1217.1.S1_at, Mtr.37466.1.S1_s_at
|
| Corresponding NCBI Gene | 824468 |
| Trichome-related Gene from Literature | N/A |