| Detail of EST/Unigene TCMT52670 |
| Acc. | TCMT52670 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S14 OS=Lupinus luteus E-value=2e-59; 40S ribosomal protein S14-2 OS=Arabidopsis thaliana E-value=5e-57; 40S ribosomal protein S14-3 OS=Arabidopsis thaliana E-value=1e-56; 40S ribosomal protein S14-1 OS=Arabidopsis thaliana E-value=4e-56; 40S ribosomal protein S14 OS=Zea mays E-value=1e-55; |
| Length | 831 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (5 ESTs); MtBB_NOD (4 ESTs); MT_JCVI-MT1 (4 ESTs); MTAMP (4 ESTs); MT_ECELL (3 ESTs); MtBC_GLOMUS (3 ESTs); MT_PhoLEAF (2 ESTs); MT_DSTEM2 (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_GESD (2 ESTs); MT_NOD_NOLLY (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MTPOSE (1 ESTs); MT_JAS_ROOR (1 ESTs); MtRHE (1 ESTs); MT_Drought (1 ESTs); MT_NOD_GVN (1 ESTs); MT_CDS (1 ESTs); MT_DFLOWER (1 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); |
| Sequence | GGCCCATATAAACGAAAACCATCGACGCTTTGTTCTCTCTGAAGAGGAAGAAGGTGCACG |
| EST members of Unigene | BT051256 DY616200 DY615881 CF069024 CA919579 AL387572 AL387571 AL383801 AL380872 AL380871 AL375774 AL375773 AW695515 AW691279 BF651136 BF650560 BF644169 EV261621 EV258196 EV257133 EV255769 BG580705 AJ503350 AJ503064 AJ503010 AJ502150 BI311397 BI310668 BI272028 BE318739 BI308527 AJ498804 BI262958 BE324263 CX535417 AA660312 BF636218 EY478659 EY477351 GE351847 GE350981 GE347450 GE348526 GE346106 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02955 small subunit ribosomal protein S14e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.20483.1.S1_at
|
| Corresponding NCBI Gene | 820324 |
| Trichome-related Gene from Literature | N/A |