Detail of EST/Unigene TCMT58840 |
Acc. | TCMT58840 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | High-affinity nitrate transporter 3.1 OS=Arabidopsis thaliana E-value=8e-38; High-affinity nitrate transporter 3.2 OS=Arabidopsis thaliana E-value=3e-37; |
Length | 762 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS (8 ESTs); MT_JCVI-MT2 (5 ESTs); MHRP-root (4 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MtSNF (3 ESTs); MT_ECELL (2 ESTs); MtBA (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_JCVI-MT3 (2 ESTs); MtBB_NOD (2 ESTs); MT_Shoots (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_Drought (1 ESTs); MT_GESD (1 ESTs); MT_DLEAF (1 ESTs); MTPOSE (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | GGATTCAGATTCTTCTCATCATAATATCATTCCAATTCCAATTGGCTTTTCTCTAAAGTC |
EST members of Unigene | AL380855 AL375597 CX528056 BG448412 BF649801 EV259119 EV259097 AW329751 AW287926 AW287890 AW287859 AW126293 AW125926 AW171659 AW126212 CA990445 BG588887 BE240708 BE240445 BE239978 CB891540 CB891177 AW736279 BG454109 AJ845754 AJ845573 AJ845563 AJ498418 BE204849 BE202624 AL371449 AL371448 BF631986 EY475878 EY474610 GE348391 GE348584 GE344232 GE345972 GE343336 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 8.A.2 Secretin auxiliary lipoprotein SAL |
Probeset |
|
Corresponding NCBI Gene | 835085 |
Trichome-related Gene from Literature | 835085 |