| Detail of EST/Unigene TCMT58872 |
| Acc. | TCMT58872 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Xyloglucan endotransglucosylase/hydrolase protein 9 OS=Arabidopsis thaliana E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein 5 OS=Arabidopsis thaliana E-value=4e-82; Probable xyloglucan endotransglucosylase/hydrolase (Fragment) OS=Glycine max E-value=1e-80; Probable xyloglucan endotransglucosylase/hydrolase OS=Triticum aestivum E-value=2e-79; Xyloglucan endotransglucosylase/hydrolase protein A OS=Phaseolus angularis E-value=8e-79; |
| Length | 1183 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DFLOWER (8 ESTs); MT_JCVI-MT2 (6 ESTs); MtBB_NOD (5 ESTs); MT_ECELL (5 ESTs); MT_GSEED (4 ESTs); MT_SIRRA (3 ESTs); MT_JCVI-MT3 (3 ESTs); MHRP-root (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_PhoLEAF (1 ESTs); MT_Shoots (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MTFLOW (1 ESTs); MT_NOD_GVN (1 ESTs); MTAMP (1 ESTs); MT_NOD_NOLLY (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_DLEAF (1 ESTs); |
| Sequence | AGACACTCACACAATTTCAGAGTAGAAGCTTCACTTCACTTCACTCTCTTCTTGTGAAGC |
| EST members of Unigene | DY618259 CA921830 AL375721 AL374583 AL374582 AL373535 AL373534 CX542332 CX541485 CX540347 CX539281 CX524333 BF651029 BF650889 BF648671 BF648234 BF647337 DW019143 AW574358 AJ501270 BG589107 BE239769 BG646180 AW773850 BQ148895 BQ148036 BQ147991 BQ147608 BQ146944 BI271753 BI271559 BI271121 BE319181 BE324506 BQ155301 BI269792 BI269341 CX529588 BE203295 AJ497318 EY478876 EY475293 EY475281 GE349172 GE349404 GE348972 GE344307 GE343826 GE344053 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.23280.1.S1_at, Mtr.43130.1.S1_s_at
|
| Corresponding NCBI Gene | 828024 |
| Trichome-related Gene from Literature | N/A |