| Detail of EST/Unigene TCMT59053 |
| Acc. | TCMT59053 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 680 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtBC_GLOMUS (5 ESTs); MT_JCVI-MT2 (4 ESTs); MTAMP (3 ESTs); MT_PhoLEAF (3 ESTs); MT_ROOTPHOS (2 ESTs); MHRP-root (1 ESTs); MTPOSE (1 ESTs); MT_SIRRA (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_JCVI-MT3 (1 ESTs); MtBB_NOD (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_GVSN (1 ESTs); |
| Sequence | GGGCGCAAAACACTACTAACAAACAACCCCATTTCCAACTTTCTCTTCTCTCCACTACCC |
| EST members of Unigene | CF069970 AL384632 AL384465 AL383933 AL383848 AL383847 AL381048 EV261716 BE998837 AW126309 AW329106 AJ503793 AJ502430 AJ501857 BG588978 AJ498617 BE323842 BE324255 BF637893 BQ157755 EY476638 GE352613 GE348330 GE349430 GE344342 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40521.1.S1_at
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |