Detail of EST/Unigene TCMT40371 |
Acc. | TCMT40371 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S20-1 OS=Arabidopsis thaliana E-value=2e-51; 40S ribosomal protein S20-2 OS=Arabidopsis thaliana E-value=9e-51; 40S ribosomal protein S20 OS=Oryza sativa subsp. japonica E-value=9e-48; 40S ribosomal protein S20 OS=Rattus norvegicus E-value=6e-42; 40S ribosomal protein S20 OS=Mus musculus E-value=6e-42; |
Length | 982 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (14 ESTs); MTFLOW (4 ESTs); MT_GSEED (3 ESTs); MT_JCVI-MT1 (3 ESTs); MT_NOD_GVN (3 ESTs); MTPOSE (2 ESTs); MtBB_NOD (2 ESTs); MtBA (2 ESTs); MT_FLOSEED_MTY (2 ESTs); MHRP-root (2 ESTs); MT_DLEAF (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_HOGA (1 ESTs); MT_ECELL (1 ESTs); MT_Drought (1 ESTs); MT_INSECT (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_JCVI-MT3 (1 ESTs); MTAMP (1 ESTs); |
Sequence | TGATTCGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCGG |
EST members of Unigene | CA922934 AL377632 AL377631 CX540996 CX536813 BI268799 BG447917 EV260218 EV259440 EV256435 DW016808 DW015993 BG582089 AW777068 AW127148 AW329849 AJ503480 BG589155 BG588804 AW683234 AJ498922 AJ498401 CX530642 BG646756 AJ497926 AJ497802 AJ497570 AJ497265 AL366412 AL366411 BG451572 BF642213 EY474163 GE352328 GE351903 GE351792 GE350876 GE350276 GE352079 GE347515 GE349168 GE347389 GE347715 GE348469 GE347996 GE345307 GE345990 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02969 small subunit ribosomal protein S20e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.50326.1.S1_at
|
Corresponding NCBI Gene | 836351 |
Trichome-related Gene from Literature | N/A |