Detail of EST/Unigene TCMT40447 |
Acc. | TCMT40447 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 74E2 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 74E1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 74F2 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 74F1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 74C1 OS=Arabidopsis thaliana E-value=0; |
Length | 2012 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR (14 ESTs); MT_HOGA (6 ESTs); MT_INSECT (5 ESTs); MT_DLEAF (4 ESTs); MT_ECELL (4 ESTs); MT_SROOT_KV2 (3 ESTs); MTAMP (2 ESTs); MT_SEEDROOT_KV3 (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_DSIL (2 ESTs); MT_GSEED (2 ESTs); MT_IROOT_DSIR (2 ESTs); MtBA (2 ESTs); MT_DSLC (1 ESTs); MT_MGHG (1 ESTs); MT_Drought (1 ESTs); MT_JCVI-MT2 (1 ESTs); MT_DROOT (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SIRRA (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
Sequence | CTGATTCGCCAGCTCGAAATTAACCCTCCTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | AW687069 CX536505 BI268486 AW207984 AW559306 AW690094 BF649252 BF648081 BF645799 BF645542 EV260994 BF005650 AJ503218 AJ503126 CB891344 AW774041 BG454511 BG453617 BG452611 BE317434 BE124087 AW127316 BM780220 BM780110 BM779985 BF637740 BQ154762 CX535474 CX535019 CX534176 CX533970 CX532558 CX532494 CX532318 CX532220 CX530273 CX530149 CX529640 CX529595 CX529108 CX528702 CB893349 CB892825 BG647588 BG647455 BG647083 BG646655 AL369833 AL369832 BE941132 BE248135 BI267218 BG449357 BF641899 BF641836 BF641729 EY476059 EY475014 GE346092 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40247.1.S1_at
|
Corresponding NCBI Gene | 837075 |
Trichome-related Gene from Literature | N/A |