| Detail of EST/Unigene TCMT40487 |
| Acc. | TCMT40487 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydroflavonol-4-reductase OS=Arabidopsis thaliana E-value=6e-74; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=7e-73; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=3e-72; Dihydroflavonol-4-reductase OS=Callistephus chinensis E-value=6e-72; Dihydroflavonol-4-reductase OS=Zea mays E-value=1e-71; |
| Length | 1288 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (7 ESTs); MT_DROOT (5 ESTs); MT_Drought (4 ESTs); MT_ECELL (4 ESTs); MTAMP (4 ESTs); MtBC_GLOMUS (3 ESTs); MtBB_NOD (2 ESTs); MT_MGHG (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_SIRRA (1 ESTs); MT_HOGA (1 ESTs); MT_SROOT_KV1 (1 ESTs); MtBA (1 ESTs); MT_IROOT_DSIR (1 ESTs); MT_Shoots (1 ESTs); MT_INSECT (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); |
| Sequence | CTGATACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
| EST members of Unigene | AL386546 AL384920 AL383703 AL378010 AL378009 AW687501 BE320221 BE319469 BE320037 BE320299 AW559635 CX525061 BF646012 BF645297 BF644768 BF643763 DW017255 AW684374 AJ504268 AJ502241 AJ501284 AJ501022 BG646007 BQ154620 CB894688 BF004347 AL371219 BE942389 BE942384 BQ144759 BQ144658 BG450499 BE248279 BQ142363 EY477410 EY475114 GE350998 GE350470 GE349856 GE345526 GE344818 GE346129 GE346128 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
| EC | 1.1.1.170 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.25021.1.S1_at
|
| Corresponding NCBI Gene | 819146 |
| Trichome-related Gene from Literature | N/A |