| Detail of EST/Unigene TCMT40555 |
| Acc. | TCMT40555 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Sucrose transport protein OS=Spinacia oleracea E-value=0; Sucrose transport protein SUC2 OS=Arabidopsis thaliana E-value=0; Sucrose transport protein SUC1 OS=Arabidopsis thaliana E-value=0; Sucrose transport protein SUC5 OS=Arabidopsis thaliana E-value=0; Sucrose transport protein SUC8 OS=Arabidopsis thaliana E-value=0; |
| Length | 2147 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (8 ESTs); MT_PhoLEAF (8 ESTs); MT_LEAF_PHOMA (5 ESTs); MT_JCVI-MT1 (5 ESTs); MT_Drought (4 ESTs); MT_INSECT (4 ESTs); MT_ECELL (3 ESTs); MtBA (3 ESTs); MT_SEEDROOT_KV3 (3 ESTs); MT_CDS (2 ESTs); MT_GPOD (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_DSIL (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_Shoots (2 ESTs); MT_SROOT_KV0 (2 ESTs); MT_VILEAF (2 ESTs); MT_KVKC (2 ESTs); MT_JAS_ROOR (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MTFLOW (1 ESTs); MT_NOD_GVN (1 ESTs); MT_DSLC (1 ESTs); MT_MGHG (1 ESTs); |
| Sequence | TGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCG |
| EST members of Unigene | BT053183 AJ459790 CF069743 CA920106 CX527016 CX524684 AW695684 AW692165 BE325429 BE325149 AW688343 AW695147 AW689431 AW688076 BF650137 BF649860 BF645566 EV262207 EV261709 EV261205 EV259738 EV257746 DW015629 BG583021 BF005994 CB892397 AW775029 AW774412 BQ141042 BQ140835 BQ139440 BQ138859 BQ138839 CA918147 BI307928 BF520636 AW775939 BE204859 BE204586 BG457602 BG457150 BG455535 BG455060 BE323944 BF638860 BF638046 BF637404 CX520979 CX520188 CX534397 AJ497198 BQ165812 BQ165811 AL369734 AL369716 AL369715 BE942036 BE249251 BF635099 BF633394 BF633370 BI266832 BI266171 BI265007 BG449527 EY476744 EY475630 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 2.A.2 Glycoside/pentoside/hexuronide,cation symporter GPH |
| Probeset |
Mtr.12339.1.S1_at, Mtr.43055.1.S1_s_at, Mtr.51896.1.S1_s_at
|
| Corresponding NCBI Gene | 838877 |
| Trichome-related Gene from Literature | 838877 |