Detail of EST/Unigene TCMT40851 |
Acc. | TCMT40851 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 40S ribosomal protein S3-3 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S3-2 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S3-1 OS=Arabidopsis thaliana E-value=0; 40S ribosomal protein S3 OS=Rattus norvegicus E-value=3e-97; 40S ribosomal protein S3 OS=Mus musculus E-value=3e-97; |
Length | 1036 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GSEED (9 ESTs); MT_SROOT_KV1 (5 ESTs); MT_DLEAF (4 ESTs); MtBB_NOD (4 ESTs); MT_JAS_ROOR (4 ESTs); MT_JCVI-MT1 (3 ESTs); MT_JCVI-MT2 (3 ESTs); MT_NOD_NOLLY (2 ESTs); MtBC_GLOMUS (2 ESTs); MtBA (2 ESTs); MT_Drought (2 ESTs); MTAMP (2 ESTs); MT_DFLOWER (1 ESTs); MT_CDS (1 ESTs); MT_PhoLEAF (1 ESTs); MT_SIRRA (1 ESTs); MT_ECELL (1 ESTs); MT_NOD_GVSN (1 ESTs); MT_ROOTPHOS (1 ESTs); MT_TRI (1 ESTs); |
Sequence | CCATTTCTCCACACACATAAGAAACTAGGGTTTCAGTATTCATTCACTGTGTGCGTGTGT |
EST members of Unigene | BT051429 DY617776 DY617761 AL381448 AL381447 AL378860 AL378859 AL378659 AL378658 CX542485 CX541840 CX541793 CX537572 CX537327 CX536684 CX536213 BI268658 BI268604 BF649802 EV257977 EV257665 EV257058 BE997808 AW329272 AJ503763 AJ501852 BQ146422 BG454457 BG454298 BE319192 BE249481 BF638162 BQ154434 CX534310 CX533649 CX532478 CX528755 BF003357 BE203445 BE202793 AI737474 AI737473 AL368666 AL368665 BG450984 BG450269 GE348715 GE347645 GE343509 EX532890 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02985 small subunit ribosomal protein S3e |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40119.1.S1_at
|
Corresponding NCBI Gene | 833518 |
Trichome-related Gene from Literature | N/A |