Detail of EST/Unigene TCMT40854 |
Acc. | TCMT40854 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Brassinosteroid-regulated protein BRU1 OS=Glycine max E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein 16 OS=Arabidopsis thaliana E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein 15 OS=Arabidopsis thaliana E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein 23 OS=Arabidopsis thaliana E-value=0; Xyloglucan endotransglucosylase/hydrolase protein 24 OS=Arabidopsis thaliana E-value=0; |
Length | 1046 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SIRRA (26 ESTs); MT_GSEED (11 ESTs); MT_JCVI-MT2 (7 ESTs); MT_JCVI-MT1 (4 ESTs); MT_DFLOWER (3 ESTs); MT_ECELL (3 ESTs); MT_JAS_ROOR (2 ESTs); MT_CDS (2 ESTs); MtBB_NOD (2 ESTs); MT_DROOT (2 ESTs); MT_DSIL (2 ESTs); MT_PhoLEAF (2 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_SROOT_KV1 (1 ESTs); MT_NOD_GVN (1 ESTs); MT_MGHG (1 ESTs); MT_GESD (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_NOD_NOLLY (1 ESTs); MHRP-root (1 ESTs); MtBC_GLOMUS (1 ESTs); MT_DLEAF (1 ESTs); MT_DSTEM2 (1 ESTs); MT_VILEAF (1 ESTs); |
Sequence | AACCTCTCTCTCTCTCTCTCTGTCCAAAATGGCTTCTAATTCTACTCACAATGAGTTTCA |
EST members of Unigene | BT052540 BT052006 DY618227 AL386986 AL376239 AL376238 BE319540 BE319308 CX542311 CX540897 CX540180 CX539800 CX538106 CX538073 CX538049 CX536945 CX536918 BI268849 BI268754 AW691431 BF650344 BF646215 BF645814 EV262509 EV261441 EV261271 EV257237 DW015952 AW980364 CA991102 BG588116 BQ149712 BQ146846 BI270982 BE317899 BE124203 AW775967 BE324103 BF637343 BQ157751 BQ157723 BQ156911 BQ156161 BQ156159 BQ156115 BQ155905 BQ155728 BQ155655 BQ155519 BQ154979 BQ154467 BQ154381 BQ154256 BQ153734 BQ153697 BQ153612 BQ153381 BQ153367 BQ153084 BQ152835 BI269946 BI269481 BI269360 BI269226 BI269082 CX520196 CX534366 CX533701 BF003859 BE943409 EY474644 GE351106 GE349539 GE349293 GE344188 GE344468 GE346376 GE346375 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.37350.1.S1_at
|
Corresponding NCBI Gene | 821955 |
Trichome-related Gene from Literature | N/A |