Detail of EST/Unigene TCMT41629 |
Acc. | TCMT41629 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cyclin-B1-2 OS=Oryza sativa subsp. japonica E-value=9e-22; Proteasome maturation protein homolog OS=Dictyostelium discoideum E-value=1e-09; Proteasome maturation protein OS=Bos taurus E-value=2e-09; Proteasome maturation protein OS=Pongo abelii E-value=1e-08; Proteasome maturation protein OS=Homo sapiens E-value=1e-08; |
Length | 820 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT2 (9 ESTs); MtBB_NOD (7 ESTs); MT_DFLOWER (5 ESTs); MtBC_GLOMUS (5 ESTs); MTAMP (4 ESTs); MT_SIRRA (4 ESTs); MT_VILEAF (3 ESTs); MtBA (3 ESTs); MT_Drought (3 ESTs); MT_GESD (2 ESTs); MT_TRI (2 ESTs); MT_DLEAF (2 ESTs); MTUS_MIXTISSUE (2 ESTs); MT_GSEED (2 ESTs); MT_NOD_ROOT (1 ESTs); MT_JCVI-MT3 (1 ESTs); MT_CDS (1 ESTs); MT_SROOT_KV0 (1 ESTs); GLSD (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
Sequence | TGATNCGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCG |
EST members of Unigene | BT051919 CF068838 CA919399 AL386446 AL383995 AL383994 AL381976 AL381975 AL380847 AL380779 AL380778 AL380134 AL380133 AL378439 AL378438 CX540786 CX540690 EV257677 AW686679 AJ503774 AJ502324 AJ502159 AJ501792 CA918574 BI310112 BQ149656 BQ148398 BQ148303 BQ147571 BQ147533 BE249739 BE318768 AI974436 BQ123012 BQ155032 BQ154721 BQ154647 BQ154194 CX522017 CX521246 CX517111 AL371809 AL371808 AL371807 BQ144752 BF635558 BF631885 EY478856 GE351047 GE351235 GE348987 GE346675 GE346674 GE346242 GE346241 GE344965 GE343844 EX532048 ES612959 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko03050 Proteasome > K11599 proteasome maturation protein |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.3001.1.S1_a_at, Msa.3001.1.S1_at
|
Corresponding NCBI Gene | 843045 |
Trichome-related Gene from Literature | N/A |