| Detail of EST/Unigene TCMT41647 |
| Acc. | TCMT41647 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 60S ribosomal protein L17-1 OS=Arabidopsis thaliana E-value=9e-85; 60S ribosomal protein L17-2 OS=Arabidopsis thaliana E-value=1e-84; 60S ribosomal protein L17 OS=Zea mays E-value=6e-82; 60S ribosomal protein L17-1 OS=Hordeum vulgare E-value=2e-80; 60S ribosomal protein L17-2 OS=Hordeum vulgare E-value=2e-78; |
| Length | 830 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT3 (4 ESTs); MtBB_NOD (4 ESTs); MT_GSEED (4 ESTs); MT_JAS_ROOR (3 ESTs); MT_Drought (3 ESTs); MT_DLEAF (3 ESTs); GLSD (3 ESTs); MtBA (2 ESTs); MT_UV-B (2 ESTs); MTAMP (2 ESTs); MT_GESD (2 ESTs); MT_JCVI-MT2 (2 ESTs); MT_NOD_NOLLY (2 ESTs); MT_ECELL (2 ESTs); MT_JCVI-MT1 (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MTFLOW (1 ESTs); MT_NOD_GVN (1 ESTs); MT_CDS (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MT_TRI (1 ESTs); MtBC_GLOMUS (1 ESTs); MTPOSE (1 ESTs); MT_SROOT_KV2 (1 ESTs); |
| Sequence | TGATGAAGTTTGTTGGTGTTGAAGTTGCAATAGAGAGGAGAGTTAAGAGAAGGAAAAGAA |
| EST members of Unigene | BT051224 DY618119 DY616583 AL383068 AL380765 AL380075 AL380074 AL374590 CX542136 CX541264 CX538825 CX537376 BF650215 BF644056 EV255409 DW016326 BG582227 DY633236 DY633117 AJ503712 AJ503582 CA918447 CA918446 BQ141139 BG452104 BE315928 BE318117 AJ498763 AW257287 BQ124682 BQ124621 BQ124475 CX535473 CX534091 CX530625 AJ497811 AL372925 AL372924 BQ145103 BF636011 BF634979 EY477403 EY477976 EY476734 EY475026 GE350865 GE345977 ES613271 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Translation > ko03010 Ribosome > K02880 large subunit ribosomal protein L17e |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.10304.1.S1_at, Mtr.31668.1.S1_s_at
|
| Corresponding NCBI Gene | 839630 |
| Trichome-related Gene from Literature | N/A |