| Detail of EST/Unigene TCMT41832 |
| Acc. | TCMT41832 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Calvin cycle protein CP12-2, chloroplastic OS=Arabidopsis thaliana E-value=3e-31; Calvin cycle protein CP12-1, chloroplastic OS=Arabidopsis thaliana E-value=4e-29; Calvin cycle protein CP12, chloroplastic OS=Chlamydomonas reinhardtii E-value=5e-14; Calvin cycle protein CP12-3, chloroplastic OS=Arabidopsis thaliana E-value=9e-14; |
| Length | 713 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (8 ESTs); MT_DLEAF (6 ESTs); MT_PhoLEAF (6 ESTs); MT_DSIL (5 ESTs); MT_VILEAF (5 ESTs); MT_GSEED (4 ESTs); MT_ECELL (4 ESTs); MTPOSE (2 ESTs); MT_MGHG (2 ESTs); MT_DFLOWER (2 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_Shoots (1 ESTs); MT_INSECT (1 ESTs); MT_DSLC (1 ESTs); MTAMP (1 ESTs); |
| Sequence | TGATNACGCCAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGC |
| EST members of Unigene | CF067921 CX540677 CX539274 CX537605 CX537456 CX523748 BQ136363 BQ135805 BQ135794 BF650112 BF006783 AJ503022 BQ146572 BI272469 BE317394 BE316114 AW682932 BF636941 BF636784 BF636749 BF521355 BF519990 BF519661 BF518708 AW775702 AJ499124 AJ498929 BQ159166 BI263749 BG457526 BF638802 BF638236 BF637692 BQ157462 BQ156204 BQ156061 BQ153999 BQ153886 BQ152918 BI269477 BI269171 CX522389 CX520928 CX520868 CX518771 CX517999 BE942543 BE942542 BQ141574 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1747.1.S1_at, Mtr.10475.1.S1_at
|
| Corresponding NCBI Gene | 825414 |
| Trichome-related Gene from Literature | N/A |