Detail of EST/Unigene TCMT42433 |
Acc. | TCMT42433 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable xyloglucan endotransglucosylase/hydrolase (Fragment) OS=Glycine max E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein B OS=Phaseolus angularis E-value=0; Xyloglucan endotransglucosylase/hydrolase protein A OS=Phaseolus angularis E-value=0; Probable xyloglucan endotransglucosylase/hydrolase protein 5 OS=Arabidopsis thaliana E-value=0; Xyloglucan endotransglucosylase/hydrolase protein 4 OS=Arabidopsis thaliana E-value=0; |
Length | 1279 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DFLOWER (15 ESTs); MT_SIRRA (12 ESTs); MT_GSEED (6 ESTs); MT_ECELL (5 ESTs); MT_FLOSEED_MTY (3 ESTs); MtBA (2 ESTs); MT_JCVI-MT3 (2 ESTs); MT_TRI (2 ESTs); MT_JCVI-MT1 (2 ESTs); MT_ROOTPHOS (2 ESTs); MTAMP (1 ESTs); MT_MGHG (1 ESTs); MTGIM (1 ESTs); MT_Drought (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_CDS (1 ESTs); MT_DROOT (1 ESTs); MT_DLEAF (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_DSTEM2 (1 ESTs); MT_VILEAF (1 ESTs); MT_HOGA (1 ESTs); MTFLOW (1 ESTs); |
Sequence | GGACAACTTAAAAACAACACACCAAAATGAGTTCTTCATTTTGGTCTTTATGTTTGATCT |
EST members of Unigene | DQ855285 BE320046 CX541327 CX541224 CX539379 CX539200 CX538915 CX538398 AW692865 BF649641 BF647611 BF645992 BF645519 BF644950 EV261499 EV256355 DW019289 DW015872 DW015682 AW329580 AW171717 AJ502141 AJ499744 CB891984 BQ149698 BQ149250 BQ149248 BQ148471 BQ148443 BI273067 BI272678 BI272234 BI271486 BI271465 BI271427 BI271323 BI271183 BI271020 BI271013 BG452265 AW257511 BQ157736 BQ157464 BQ156258 BQ155751 BQ155055 BQ154641 BQ154563 BQ154454 BQ154391 BI269658 BI269315 BI269190 CX522346 CB892660 AJ497807 AL372877 AL372876 BE943073 BE248043 EY478168 EY477082 EX532178 ES612119 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.22601.1.S1_s_at
|
Corresponding NCBI Gene | 831233 |
Trichome-related Gene from Literature | N/A |